Evolution will find forms and processes that exploit the possibilities inherent in this delightful slice-of-life medium.

Vertestomata parvulus, 12 hours after fertilization

Vertestomata parvulus, 3 days after fertilization

Vertestomata parvulus, 5 days

Vertestomata parvulus, 8 days, full cycle, obligatory Kodak moment

"What's the quarrel over lifeless matter now?"

(Hybrid text passage, Chapter 4 of Frankenstein by Mary Wollstonecraft Shelley (1818) and Chapter 4 of Through the Looking-Glass by Lewis Carroll (1871), interwoven, with just a pinch of base-paired DNA sequence.)

They were standing in her laboratory and, after a rather awkward pause, attracted her attention to the structure of the human frame. One of them had 'ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCC' embroidered on his collar, and the other 'CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCA'. They held out the two hands that were free. “I'm sure I'm very sorry,' was all Alice could say. Her affectionate hug was at first moderate, as if cowardice or carelessness did not restrain very politely. "I suppose they've each conceived that progress is ringing through my head like 'incipient disease'," she said to herself. "If it was so", she proceeded, "it has gained strength, and will soon disappear in the light of morning."

"If you think we're wax-works," said a voice coming from the one marked 'CTGC(...)', black as a tar-barrel, "our most heartfelt exultation seeks a great deal of sound sense and real information."  His manners, monstrous and facile, became so ardent and eager that the stars were driven away. She wished, as it were, to procrastinate all that related to her feelings of affection until the great object, which swallowed up every habit of her nature, should be completed. She promised herself to both of them. “My ardour is indeed tinged by dogmatism”.

"You ought to pay attention, you know," said First Boy. "Wax-works weren't made to be continual food for discovery and wonder."

"Contrariwise," added Next Boy. "I was thinking of one object of pursuit, fluctuating and uncertain; yet whilst I was engaged in the mystery of natural philosophy, and believing that exercise and amusement would then spoil his nice new receptacle of bodies deprived of life, she bustled about, looking to have a battle for nothing, nohow!"  

"Then we'd better not fight to-day," said Alice, thinking it a good opportunity to proceed recording the vision of a madman.

“We MUST have a bit of a fight, but I don't care about the path of knowledge," said ACAA(...). " A mind acquainted with the attainment of this phenomena should take an irresistible hold of my imagination. It is a prospect conducive to the sense stimulus of the corruption of death. That WOULD be grand!"

"What's the quarrel over lifeless matter now?", asked Alice, and grinned with an almost supernatural enthusiasm.

"From this day, it's the end of a new species," said 'CTGC(...)', and looked at his watch. "I may be easily its creator and source, particularly at half-past four."

They stood so still that she quite forgot which is the best way out, dizzy with the immensity of the prospect of her creation. They were alive, and improved so rapidly that it was made the food for the worm. She just looked round to see if the word "poetry" was written in any hiding-places, but it was getting so dark.  

"I know what you're thinking,' said 'CTGC(...)', an arm round the other's neck. "Let's fight till six, and then cultivate the acquaintance of the men of science." His gentleness was never solely wrapped in logic, and Alice knew which animal endued with life was which in a moment. In genius and discrimination she had found a true friend. She at once took hold of one glimmering and seemingly ineffectual light (she remembered afterwards, for fear of hurting the other one's feelings). This seemed quite natural, and as the best way out of the difficulty was to shake hands, dancing round in a ring with great esteem and admiration for the light so brilliant and wondrous. The next moment she got well acquainted with the theory and practice of natural philosophy as depended on the lessons of any of the professors at Ingolstadt.

“Whence”, she often asked herself, “did the principle of life proceed? If it was so, it might be; and if it were so, it would be; but as it isn't, it ain't,” and shut her mouth up again with a snap.

Ein einziges gelbes Fehlen

Eine Öffnung in der crocinocephalen Aufspannung reformiert nicht, sondern unterstreicht vielmehr, dass einige der Lösungen x₁, x₂, ... mit den mit Himbeergeschmack abgebauten Bakterien als theologisch dargestelltes Problem übereinstimmen, indem sie für den Wert und die Würde deutscher Blutspendedienste eintreten.

Voraussetzungen zur Schaffung

Die gegenüber gewonnenen Weibchen werden in einer unwillkürlichen Bildung von potentieller ”Verschwörer”- Gegner verwandelt, die man keinesfalls als imaginär einstufen darf. Dass es eine Abstimmung der monotheistischen Sozialordnungen überhaupt gibt ist Grund genug, eigene der fremden Strukturen aus dem Club zu verbannen. Selbst der Papst hat es für uns sichtbar gemacht, mit welcher bestechend einfachen und erfolgreichen Methoden es ihm gelang, den Kontakt zwischen den beiden Hälften entstehen zu lassen und anschließend die Strukturen wiederzuverwerten. "Aufgewühlt” soll er sich hinterher gefühlt haben, "erschöpft", "massiv verändert". (Die Allgemeinheitsbezeichnung enthält ja ein Urbild). So ist der telencephale Anteil des Paraphysal-ectovulgaris, weiblicher Adultus über einen dünnen, der ursprünglichen Anlage der kulturpessimistischen Klage zum Gegenstand kommerzieller Nutzung geworden, letztenendes ein einziges gelbes Fehlen.

Whatever happened to the Snowdens of yesteryear?

I tried to tell him, evaluation of four rebounds and eight steals from finger or mouth to anus (or vice- versa) is ultimately only 4 of the transformations — about 6,900 miles across, or slightly smaller than Venus — so lucidly described in Dr.'s localized breast tenderness. Have you ever used your creativity to help describe any inpatients?, challenged any combination of these Eskimos' crowning achievements? And if that weren't the otherwise large triangular and tusk-like mass University of Virginia Tournament, I don't know what is. It seemed to drew a substantial description life relations of woman's autonomous Wo, possibly won 1995 slowly through word of mouth, having argued endlessly on the phone and corresponded for half a year. Nevertheless, we were forced to conclude that in total, of the approximately 3½ x 5" marriage-minded Wonderlick, 76% suffered rational human social form and 40% of the outpatients usually discovered major depression without melancholic features. 3. Dry Thursday through Saturday, and probably through Sunday. A disturbance will be passing nearby tomorrow night and Wednesday most models keep if far enough to the east to keep us dry. One of the serious shit, man. I ain't kiddin'. Complete and sanitary. Models which I checked, however, have a more westward track. 20% chance of showers (not the other type!). The main impact of this feature will be to keep things chilly and windy. Next week is best described by a coarse model who shows "above normal rainfall" and "below normal temperature". No casting it in a green-blue with wispy white clouds. Buy our own featureless Uranus or Neptune, it’s more than an artistic quibble, and not so good for a press release, since the closer and hotter the planet, is also the smaller, and it resides about 5 million miles from its star (below). 

 

Six random dice numbers haikus

52443
4625341
64424.


53511
4424565
23622.


33411
2611334
36165.


33554
3256156
31162.


13634
3155543
36136.


32462
5436641
24661.

The Occasional Synthesizer Piercing Through The Mix

    No matter what size of town or city you live in, by surrendering to Universal Love, there will be at least one person who will be able to create your culinary masterpiece for you. Ask around!

    In a large bowl, mix flour and baking powder. Add the bell peppers, onions, garlic, parsley, thyme, and sixties influence. Assimilate the bleach-soaked offerings of the occasional synthesizer piercing through the mix. If white hot tubbing, get groped under the water. Stir in milk, blood, guts & pussy; beat batter well. Behead the conch at two-minute intervals, salt (if desired) and then shelter them for weeks at a time from nosy neighbors and passing traffic. In deep skillet or electric fryer, it will then reverse stabilomator deflections from a conventional plane to give the correct response. Heat oil to 375°F (the highest rating). Using slotted spoon, have sex with someone whose language you don’t (or didn’t) know, then remove fritters; transfer to separate bowl to drain. Pray regularly to a charismatic God of your choice, his calming voice echoing through my ears (mango-kiwi-tropical swirl). Should make about 6 appetizer servings, but it’s the 21 minutes that encompasses the whole world of My every thought which retains the same chilling temperature throughout the year. Despite the Stalin era, I sure did have a terrific laugh.

Randomly generated lines using a map of Europe

   In this project, lines are generated based on existing roads (land routes, and if necessary, ferry routes) within Europe.

    Each line represents a path between 2 randomly selected cities, usually along major national/international highways; with the help of Google Maps, the most direct route between these 2 cities is determined. Each of the drawings posted below is a composite of 6 separate lines (6 separate routes); the routes are not individually numbered.

    In order to make random selection by means of „dice numbers“ practical, 36 countries have been selected* (see list below) and listed in alphabetical order. From each country, 36 cities have been selected, and these are also represented as a separate list, in order of decreasing population.

    To further facilitate the selection process using dice numbers, the list of 36 countries, as well as each list of 36 cities within each country, is grouped into 6 subsets of 6 – broken down as follows:

       subset 1       1-6

       subset 2       7-12

       subset 3       13-18

       subset 4       19-24

       subset 5       25-30

       subset 6       31-36.    

   See a complete list of 36 countries at the end of this post.

    For each drawing, 2 multiple-choice tables have been set up; ‘Table A’ breaks down the 36 countries into 6 subsets of 6 countries, and ‘Table B’ breaks down the 36 cities within each country into 6 subsets of 6 cities. Within the selection process of each separate drawing, each country and city within its own subset is further randomly renumbered: in other words, assigned a separate number between 1-6. This was done in order to increase the „randomness factor“, and may or may not be stochastically legitimate, but it makes me feel good to not have all lists „merely“ numbered 1 through 6.

    In this manner, 4 dice numbers are sufficient enough to select a specific city. The first number selects the Country-Subset 1-6, and the second number selects the specific country 1-6 within that subset; the third number selects a City-Subset, and the fourth number selects the specific city within that subset.

    The following is an example intended to illustrate this selection process (only in this example are the lists numbered 1 through 6!):

       4 dice numbers are selected: 3 2 5 6.

       3 =  Country-Subset 3

       2 =  second country within Country-Subset 3 = „country 14“ = Great Britain

       5 =  City-Subset 5

       6 =  sixth city within City-Subset 5 = „city 30“ = Portsmouth

    In the section „table configuration“ in the text of each drawing, some numbers are marked in red, which denote those numbers which were not used for the intended purpose (and are therefore classified as „inert“). For example, when configuring a table with 6 options, 5 different random numbers are needed, the sixth being automatically added by default. If that doesn't make sense, look at a Table A or B in the text of one of the drawings, you'll get it, trust me.

List of 36 countries

01 Albania

02 Austria

03 Belarus

04 Belgium

05 Bosnia + Herzegovina

06 Bulgaria

07 Croatia

08 Czech Republic

09 Denmark

10 Estonia

11 Finland

12 France

13 Germany

14 Great Britain

15 Greece

16 Hungary

17 Iceland

18 Ireland

19 Italy

20 Latvia

21 Lithuania

22 Luxembourg

23 Macedonia

24 Moldova

25 Netherlands

26 Norway

27 Poland

28 Portugal

29 Romania

30 Serbia

31 Slovakia

32 Slovenia

33 Spain

34 Sweden

35 Switzerland

36 Turkey

A series of six drawings may be viewed in the following six posts!

   To access all 36 lists of countries with their respective cities, please go to www.tedgreen.net/dicepaintings.html and click on the pdf-link „**“ at the the top of the page.

* A few words on the pre-selection of a 36-country range: Europe does not have universally accepted borders, when considered as a geographical continent nor as a political entity, so reducing it to a „container“ with exactly 36 countries was a doomed endeavor from the start, and I admit, the solution is by no means perfect. Some nations have been included which may not necessarily be considered to be „European“ in a historical sense (i.e, former Soviet republics), and nations have been excluded which most if not all people would indeed consider to be European, namely Montenegro and Cyprus. I apologize to any viewers who may feel slighted. This is a virtual art project, and does not reflect any political, social or ethnical opinions whatsoever.

    The easiest consideration for this project was “no midget nations”, so Andorra, Liechtenstein, Malta, San Marino and Vatican City were not included. Working from west to east, it was simple at first, but it got tricky behind the former Iron Curtain. As far as former Soviet republics go, the 3 Baltic nations seemed to be a no-brainer, so then I added Belarus as well, but for some reason balked at adding Ukraine. Russia is widely considered to belong to Europe, but since it stretches all the way to the Pacific, it's classified even more so as being a part of Asia, so it's out. I had no problem including Turkey, but by then I had 35 countries. In retrospect, I should have added Montenegro, the only former Yugoslav republic not included in the list; I admit, Cyprus didn't even come into consideration. As it turned out, I added Moldova, making 36, but like I mentioned above, the solution is not perfect.