Samstag, 26. Dezember 2015

"What's the quarrel over lifeless matter now?"



(Hybrid text passage, Chapter 4 of Frankenstein by Mary Wollstonecraft Shelley (1818) and Chapter 4 of Through the Looking-Glass by Lewis Carroll (1871), interwoven, with just a pinch of base-paired DNA sequence.)

They were standing in her laboratory and, after a rather awkward pause, attracted her attention to the structure of the human frame. One of them had 'ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCC' embroidered on his collar, and the other 'CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCA'. They held out the two hands that were free. “I'm sure I'm very sorry,' was all Alice could say. Her affectionate hug was at first moderate, as if cowardice or carelessness did not restrain very politely. "I suppose they've each conceived that progress is ringing through my head like 'incipient disease'," she said to herself. "If it was so", she proceeded, "it has gained strength, and will soon disappear in the light of morning."

"If you think we're wax-works," said a voice coming from the one marked 'CTGC(...)', black as a tar-barrel, "our most heartfelt exultation seeks a great deal of sound sense and real information."  His manners, monstrous and facile, became so ardent and eager that the stars were driven away. She wished, as it were, to procrastinate all that related to her feelings of affection until the great object, which swallowed up every habit of her nature, should be completed. She promised herself to both of them. “My ardour is indeed tinged by dogmatism”.

"You ought to pay attention, you know," said First Boy. "Wax-works weren't made to be continual food for discovery and wonder."

"Contrariwise," added Next Boy. "I was thinking of one object of pursuit, fluctuating and uncertain; yet whilst I was engaged in the mystery of natural philosophy, and believing that exercise and amusement would then spoil his nice new receptacle of bodies deprived of life, she bustled about, looking to have a battle for nothing, nohow!"  

"Then we'd better not fight to-day," said Alice, thinking it a good opportunity to proceed recording the vision of a madman.

“We MUST have a bit of a fight, but I don't care about the path of knowledge," said
ACAA(...). " A mind acquainted with the attainment of this phenomena should take an irresistible hold of my imagination. It is a prospect conducive to the sense stimulus of the corruption of death. That WOULD be grand!"

"What's the quarrel over lifeless matter now?", asked Alice, and grinned with an almost supernatural enthusiasm.

"From this day, it's the end of a new species," said 'CTGC(...)', and looked at his watch. "I may be easily its creator and source, particularly at half-past four."

They stood so still that she quite forgot which is the best way out, dizzy with the immensity of the prospect of her creation. They were alive, and improved so rapidly that it was made the food for the worm. She just looked round to see if the word "poetry" was written in any hiding-places, but it was getting so dark.  

"I know what you're thinking,' said 'CTGC(...)', an arm round the other's neck. "Let's fight till six, and then cultivate the acquaintance of the men of science." His gentleness was never solely wrapped in logic, and Alice knew which animal endued with life was which in a moment. In genius and discrimination she had found a true friend. She at once took hold of one glimmering and seemingly ineffectual light (she remembered afterwards, for fear of hurting the other one's feelings). This seemed quite natural, and as the best way out of the difficulty was to shake hands, dancing round in a ring with great esteem and admiration for the light so brilliant and wondrous. The next moment she got well acquainted with the theory and practice of natural philosophy as depended on the lessons of any of the professors at Ingolstadt.

“Whence”, she often asked herself, “did the principle of life proceed? If it was so, it might be; and if it were so, it would be; but as it isn't, it ain't,” and shut her mouth up again with a snap.